View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_85 (Length: 260)
Name: NF4445_high_85
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 8480526 - 8480277
Alignment:
| Q |
1 |
ctaatacttgggtgccatcagttaaatgttacttctcggtgagttttgttttaatccatatgatgaatatgtatctggtttatatatttatttatattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8480526 |
ctaatacttgggtgccatcagttaaatgttacttctcggtgagttttgttttaatccatatgatgaatatgtatctggtttatatatttatttatattct |
8480427 |
T |
|
| Q |
101 |
gattttggctttgttaatgtgtttttgcatgttggtgcagcttgcatgtttagtccatgctaagtacaagtctagccagtcaagtacctacaagccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8480426 |
gattttggctttgttaatgtgtttttgcatgttggtgcagcttgcatgtttagtccatgctaagtacaagtctagccagtcaagtacctacaagccaaat |
8480327 |
T |
|
| Q |
201 |
ggtttgtcttcttcttttgttttttgaggatctgcctttgtttgtttcat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8480326 |
ggtttgtcttcttcttttgttttttgaggatctgcctttgtttgtttcat |
8480277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University