View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_high_89 (Length: 255)

Name: NF4445_high_89
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_high_89
NF4445_high_89
[»] chr5 (1 HSPs)
chr5 (19-255)||(2386556-2386792)


Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 2386556 - 2386792
Alignment:
19 gaaacaggaacaaccccttgcaaattgttgttagccaaattcaattgtttcaacaatggcaagcttatatcaggaatttcaccggaaagcgagttgtttg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2386556 gaaacaggaacaaccccttgcaaattgttgttagccaaattcaactgtttcaacaatggcaagcttatatcaggaatttcaccggaaagcgagttgtttg 2386655  T
119 cgagattcaaataaacaaggtgactcaaattggaaagagataaaggaatttcaccaatgaaacggttattagacaaattaacaacagataaattcttcca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2386656 cgagattcaaataaacaaggtgactcaaattggaaagagataaaggaatttcaccaatgaaacggttattagacaaattaacaacagataaattcttcca 2386755  T
219 aacagcaaaatctggcaatggacctatgatattgttg 255  Q
    |||||||||||||||||||||||||||||||||||||    
2386756 aacagcaaaatctggcaatggacctatgatattgttg 2386792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University