View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_99 (Length: 250)
Name: NF4445_high_99
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_99 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 2293954 - 2293713
Alignment:
| Q |
10 |
gcataggttgtgaaaagtaataatctaaagaattaggtctctcgttaagtttgagtaaaagcccaattaacctttacatannnnnnnagcccaaaaaccc |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2293954 |
gcataggttgggaaaagtaataatctaaagaattaggtctctcgttaagtttgagtaaaagcccaattaacctttacatatttttttagcccaaaaaccc |
2293855 |
T |
|
| Q |
110 |
atcaataaacctctttgaatcagatttacaccttcaacaaaaacacattcttcttcttttcctgtatcgtc-ttctaccctagccatgtcttcttccaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2293854 |
atcaataaacctctttgaatcagatttacaccttcaacaaaaacacattcttcttcttttcctgtatcgtctttctaccctagccatgtcttcttccaaa |
2293755 |
T |
|
| Q |
209 |
gatgcagacccaaccctaggttacctcactcgaaatgatacc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2293754 |
gatgcagacccaaccctaggttacctcactcgaaaagatacc |
2293713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 186 - 243
Target Start/End: Original strand, 34787420 - 34787477
Alignment:
| Q |
186 |
ccctagccatgtcttcttccaaagatgcagacccaaccctaggttacctcactcgaaa |
243 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34787420 |
ccctagccatgtcttcttccaaagttgcagacccaaccctaggttacctcactcgaaa |
34787477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University