View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_101 (Length: 255)
Name: NF4445_low_101
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_101 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 18571676 - 18571916
Alignment:
| Q |
13 |
gagatgaatgatgaaatctcaatgtttgttgtatgattcttgtattttaattgtgtgcgcgcgcggtcgttacatggaaatgtctatttttatgtcgtat |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||| | ||||||| |
|
|
| T |
18571676 |
gagatgaatgatgaaatctcaaagtttgtagtatgattgttgtattttaattgtgtgcgcgcgcggttgttacatggaaatgtatattt--aagtcgtat |
18571773 |
T |
 |
| Q |
113 |
gtttcgttttatagttcgttttccttcggatttgtgttgtattatagattttcctagagtttaggccatgttatatgtcgaaatagaaacaccattctat |
212 |
Q |
| |
|
|||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18571774 |
gtttcgctttatagttctttttccttcagatttgtgttgtattatagattttcctagagtttaggccatgttatatgtcgaaatagaaacaccattctat |
18571873 |
T |
 |
| Q |
213 |
caaacattttcactcattccatttactatgatatctttactta |
255 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18571874 |
caaacattttcactcattccgtttactatgatatctttactta |
18571916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University