View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_107 (Length: 251)
Name: NF4445_low_107
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 53 - 235
Target Start/End: Complemental strand, 38489011 - 38488828
Alignment:
| Q |
53 |
gacactgatgtatggttatatt-gaagtccacagcttttgtctgatattgaaacaaaacatgacaaaatgcaagccacgacatgatttaattatatgcag |
151 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38489011 |
gacactgatgtatggttatatttgaagtccacagcttttgtctgatattgaaacaaaacatgacaaaatgcaagccacgacatgatttaattatatgcag |
38488912 |
T |
 |
| Q |
152 |
cttcaactagtggccacatgggatgcattcaaggagtaatctttccattcttctgattttgaaccaaagtttgagaattgctct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38488911 |
cttcaactagtggccacatgggatgcattcaaggagtaatctttccattcttctgattttgaaccaaagtttgagaattgctct |
38488828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University