View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_113 (Length: 248)
Name: NF4445_low_113
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 15644561 - 15644331
Alignment:
| Q |
17 |
aagaacagcaataagtatccttaaagttagtttagtggcctccttttctaaaacctcnnnnnnnnnnnnnnnnnnnngagagtttctcattctcttacga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
15644561 |
aagaacagcaataagtatccttaaagttagtttagtggcctccttttctaaaacctctttttctacttttcttttttgggagtttctcattctcttacga |
15644462 |
T |
 |
| Q |
117 |
aagctag----tgagaacgagtttggcattattattgggactaagggaaacataatttcacgtataccataccatatcacacgaaacaattgtgcaccct |
212 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15644461 |
aagctagctagtgaaaacgagtttggcattattattgggactaagggaaacataatttcacgcataccataccatatcacacgaaacaattgtgcaccct |
15644362 |
T |
 |
| Q |
213 |
aacaaaaacaaattaaaaaacatgaaacatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15644361 |
aacaaaaacaaattaaaaaacatgaaacatg |
15644331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University