View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_121 (Length: 243)
Name: NF4445_low_121
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_121 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 26490614 - 26490404
Alignment:
| Q |
19 |
gaagagccagcatttagtggtcaattttatgggctgtaattgagaaaaagcacttgaggcaatatatagctgaagcatacttttattttgcttcaggcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26490614 |
gaagagccagcatttagtggtcaattttatgggctgtaattgagaaaaagcacttgaggcaatatatagctgaggcatacttttattttgcttcaggcaa |
26490515 |
T |
|
| Q |
119 |
tataatataaactgttaagtttatttatgaactagctagccaatatttcttgatatccacatttgttgcatctttttgtgttggtgacttggtggtgaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26490514 |
tataatataaactgttaagtttatttatgaactagctagccaatatttcttgatatccacatttgttgcatctttttgtgttggtgacttggtggtgaag |
26490415 |
T |
|
| Q |
219 |
ccattgtctgt |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
26490414 |
ccattgtctgt |
26490404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University