View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_123 (Length: 241)
Name: NF4445_low_123
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_123 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 84 - 235
Target Start/End: Complemental strand, 31647103 - 31646945
Alignment:
| Q |
84 |
ctaggtctcacctaatgatgattggagcttcttgccaccttatatgatcaattaaagcgtgaagttgccttctagtggatatgataacact-------tt |
176 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||| | |||||||||| ||| || |
|
|
| T |
31647103 |
ctaggtctcacctaatgatgtttggagcttcttgccaccttataaaatcaattaaagtgtgaagttgccttctaatagatatgataaaacttttataatt |
31647004 |
T |
|
| Q |
177 |
tataaacccttagaaatagagttgtcttctctaaagatatgagtcactgtgaaattcat |
235 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31647003 |
tataaaccgttaaaaatagaattgtcttctctaaagatatgagtcaccgtgaaattcat |
31646945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 31647213 - 31647148
Alignment:
| Q |
16 |
gtcaaatataccccaaaccttatcaaaatgtgacaaacctaaa-ttgggcattcccaacatgttat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
31647213 |
gtcaaatataccccaaaccttatcaaaatgtgacaaacttaaagttgggcattcccagcatgttat |
31647148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University