View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_low_123 (Length: 241)

Name: NF4445_low_123
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_low_123
NF4445_low_123
[»] chr2 (2 HSPs)
chr2 (84-235)||(31646945-31647103)
chr2 (16-80)||(31647148-31647213)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 84 - 235
Target Start/End: Complemental strand, 31647103 - 31646945
Alignment:
84 ctaggtctcacctaatgatgattggagcttcttgccaccttatatgatcaattaaagcgtgaagttgccttctagtggatatgataacact-------tt 176  Q
    |||||||||||||||||||| |||||||||||||||||||||||  ||||||||||| |||||||||||||||| | |||||||||| |||       ||    
31647103 ctaggtctcacctaatgatgtttggagcttcttgccaccttataaaatcaattaaagtgtgaagttgccttctaatagatatgataaaacttttataatt 31647004  T
177 tataaacccttagaaatagagttgtcttctctaaagatatgagtcactgtgaaattcat 235  Q
    |||||||| ||| ||||||| |||||||||||||||||||||||||| |||||||||||    
31647003 tataaaccgttaaaaatagaattgtcttctctaaagatatgagtcaccgtgaaattcat 31646945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 31647213 - 31647148
Alignment:
16 gtcaaatataccccaaaccttatcaaaatgtgacaaacctaaa-ttgggcattcccaacatgttat 80  Q
    |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||    
31647213 gtcaaatataccccaaaccttatcaaaatgtgacaaacttaaagttgggcattcccagcatgttat 31647148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University