View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_low_126 (Length: 240)

Name: NF4445_low_126
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_low_126
NF4445_low_126
[»] scaffold0013 (2 HSPs)
scaffold0013 (69-240)||(39034-39205)
scaffold0013 (26-143)||(39173-39290)


Alignment Details
Target: scaffold0013 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 69 - 240
Target Start/End: Complemental strand, 39205 - 39034
Alignment:
69 atgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacacaattcgccgaggatttgatgtttatatgcaattttaacatgat 168  Q
    ||||||||||||| ||| || ||||| |||  |||||||||| |||||||| |||| || || |||||||||||||||||||||||||||||||||||||    
39205 atgcacatattacacaattcgccgagtatttgaagtattttattgcacatactacaaaactcaccgaggatttgatgtttatatgcaattttaacatgat 39106  T
169 ttgatatgtttataagtggtcagtcttgaaaatgatttttagtctatgctattgagaaagactaatagtgtt 240  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
39105 ttgatatgtttataagtggccagtcttgaaaatgatttttagtctatgctattgagaaagactgatagtgtt 39034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 26 - 143
Target Start/End: Complemental strand, 39290 - 39173
Alignment:
26 catcaggcacaatataattattattcttcttctcttgactcatatgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacac 125  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39290 catcaggcacagtataattattcttcttcttctcttgactcatatgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacac 39191  T
126 aattcgccgaggatttga 143  Q
    ||||||||||| ||||||    
39190 aattcgccgagtatttga 39173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University