View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_132 (Length: 237)
Name: NF4445_low_132
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_132 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 32187815 - 32187608
Alignment:
| Q |
19 |
actagatgttaaggatctttgatgtggaattattttatcatcataagatctcacaaaccaaatgattttgagggagtactgttaaatgagccatagaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32187815 |
actagatgttaaggatctttgatgtggaattattttatcatcataagatctcacaaaccaaatgattttgagggagtactgttaaatgagccatagaagt |
32187716 |
T |
 |
| Q |
119 |
gtgtctcgggttgagaaagaaaggtatatgaaagtaggggcaaatttgaattgtccatccacccatgtggtgacatataattatagttaatcctcgtaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
32187715 |
gtgtctcgggttgagaaagaaaggtatatgaaagtaggggcaaatttgaattgtccatccacccatgtggtgacatataactatggttaatcctcgtaac |
32187616 |
T |
 |
| Q |
219 |
tgatgatg |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
32187615 |
tgatgatg |
32187608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University