View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_137 (Length: 233)
Name: NF4445_low_137
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_137 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 17328971 - 17329169
Alignment:
| Q |
16 |
atgaatgaataaaattaccaaatcccaaaagcaccaatgctgaagatagcagaccaaacaccccaatgatcatcagctgatatgataggatatctcagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17328971 |
atgaatgaataaaattaccaaatcccaaaagcaccaatgctgaagatagcagaccaaacaccccaatgatcatcagatgatatgataggatatctcagct |
17329070 |
T |
|
| Q |
116 |
gtgacttcactgcaacaacacttcgacttatacgaggttcctttgacagatacgaggtaattgtcatggtcgtgtgttgaggttgaagtacgaggtttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17329071 |
gtgacttcactgcaacaacacttcgagttatacgaggttcctttgacagatacgaggtaattgtcatggtcgtgtgttgaggttgaagtacgaggtttg |
17329169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 30746025 - 30745965
Alignment:
| Q |
20 |
atgaataaaattaccaaatcccaaaagcaccaatgctgaagatagcagaccaaacacccca |
80 |
Q |
| |
|
|||||| |||||||||||||||||||||| | ||||||||||| | ||| ||||||||||| |
|
|
| T |
30746025 |
atgaatgaaattaccaaatcccaaaagcatcgatgctgaagatgggagatcaaacacccca |
30745965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University