View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_138 (Length: 233)
Name: NF4445_low_138
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_138 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 6 - 233
Target Start/End: Complemental strand, 18572163 - 18571933
Alignment:
| Q |
6 |
agtcggtgaaatgacaaaatcaatggttgatattctaacaaccattgattgttacgttgaaaaatgctagcaacacactttccgacatctctctttct-- |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18572163 |
agtcggtgaaatgacaaaatcaatggttgatattctaaccaccattgattgttacgttgaaaaatgctagcaacacactttccgacatctctctttctat |
18572064 |
T |
 |
| Q |
104 |
-ggttgaaattcatataggcctacccaatctatgtgtgtgccacattttttagtgggtcccatttaaatttcaaccaatggaaaggagtgtgttgaaaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18572063 |
tggttgaaattcatataggcctacccaatctatgtgtgtcccacattttttagtgggtcccatttaaatttcaaccattggaaaggagtgtgttgaaaaa |
18571964 |
T |
 |
| Q |
203 |
cgtgtgttaaaagtgtgttaccagtactctt |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
18571963 |
cgtgtgttaaaagtgcgttaccagtactctt |
18571933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 45300426 - 45300366
Alignment:
| Q |
151 |
tttagtgggtcccatttaaatttcaaccaatggaaaggagtgtgttgaaaaacgtgtgtta |
211 |
Q |
| |
|
||||||||||||||| | |||| ||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
45300426 |
tttagtgggtcccatatgtattttaaccaatcaaaaggagtgtgttgaaaaatgtgtgtta |
45300366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University