View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_151 (Length: 211)
Name: NF4445_low_151
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_151 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 5 - 204
Target Start/End: Original strand, 32313301 - 32313500
Alignment:
| Q |
5 |
gggatgggagggtggagacgcaatgtctccttgatggcacactttagataagtgagtttctcgatgtccgattcctccacgcgccggtctaggccaacaa |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32313301 |
gggatgggagggtggagacgcaacgtctccttgacggcacactttagataagtgagtttctcgatgtctgattcctccacgcgccggtctaggccaacaa |
32313400 |
T |
|
| Q |
105 |
cagtggcgagttcttgttgcacacgctttagttcttctggatttctcattagctccgacattgcccattccattgctgatgctactgtctctgctcctcc |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
32313401 |
caacggcgagttcttgttgcacacgctttagttcttctggatttctcattagctccgacattgcccattccattgctgatgctactgtttctgttcctcc |
32313500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 5046181 - 5046257
Alignment:
| Q |
9 |
tgggagggtggagacgcaatgtctccttgatggcacactttagataagtgagtttctcgatgtccgattcctccacg |
85 |
Q |
| |
|
||||||||||||||||||| || ||||| | | | || |||| |||||||||||||||||| || | |||||||||| |
|
|
| T |
5046181 |
tgggagggtggagacgcaacgtttccttaacgacgcattttatataagtgagtttctcgatatctgtttcctccacg |
5046257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University