View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_26 (Length: 460)
Name: NF4445_low_26
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 48 - 444
Target Start/End: Complemental strand, 37549326 - 37548930
Alignment:
| Q |
48 |
agaaggatgcatctacattacatttgtatctacctatcgcattggtagtttccggcgcgtgtctttcataggagctagtgattggtgaatttgtctctta |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37549326 |
agaaggatgcgtctacattacatttgtacctacctatcccgttggtagtttccggcgcgtgtctttcataggagctagtgattggtgaattcgtctctta |
37549227 |
T |
 |
| Q |
148 |
accttttggtagagcttcaacttgtgatcagcaatgtagctcaatcccacggaccttgaattgttggagtttgcatgtatactcgtttacgcagtcttat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
37549226 |
accttttggtagagcttcaacttgtgatcagcaatgtagctcaatcccacggaccttgaattgttgcagtttgcatgtatactcgtttatgcagtcttat |
37549127 |
T |
 |
| Q |
248 |
aatagaagttgtttaatcaaaattagacggtttaaatccaattcgatatttttaatggtagagtaaataatgaaatctgcattttctgagtcataagatc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549126 |
aatagaagttgttcaatcaaaattagacggtttaaatccaatttgatatttttaatggtagagtaaataatgaaatctgcattttctgagtcataagatc |
37549027 |
T |
 |
| Q |
348 |
ctagactaaacaatcttcaatgtcatgtctgcgtgaatacatgaaagcacaaacaatagaaaatcctatttcccggtcgcaacacgggttgagatct |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
37549026 |
ctagactaaacaatcttcaatgtcatgtctgcgtgaatacttgaaagcactaacaatagaaaatcctatttccccgtcgcaacactggttgatatct |
37548930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University