View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_35 (Length: 401)
Name: NF4445_low_35
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 20 - 378
Target Start/End: Original strand, 19696749 - 19697107
Alignment:
| Q |
20 |
gaaaacgcggtcgagagggtcagttcccactccgggattagatgagaggaaagagcgggagagttgtttgaggcgacggatggggaaagggtattcggtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19696749 |
gaaaacgcggtcgagagggtcagttcccactccgggattagatgagaggaaagagcgggagagttgtttgaggcgacggatggggaaagggtattcggtg |
19696848 |
T |
|
| Q |
120 |
aatatgtagagtgatgaagcggagaggccgccgtgggagggtggaagctgagccgtgaggacgagttgaaggcagatttgggttttaccgcttccgcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19696849 |
aatatgtagagtgatgaagcggagaggccgccgtgggagggtggaagctgagccgtgaggacgagttgaaggcagatttgggttttaccgcttccgcttt |
19696948 |
T |
|
| Q |
220 |
cggcgacgagttcggtcactgattttgtggggatgccgccggcgaggcagcgatcaagaacgggacaccctacgctgcatttctcggttttttggtggag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19696949 |
cggcgacgagttcggtcactgattttgtggggatgccgccggcgaggtagcgatcaagaacgggacaccctacgctgcatttctcggttttttggtggag |
19697048 |
T |
|
| Q |
320 |
ctcatgcactagattctgcgccgctgtgctcatctcgctattgtgattgtgattgtgat |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19697049 |
ctcatgcactagattctgcgccgctgtgctcatctcgctattgtgattgtgattgtgat |
19697107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University