View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_50 (Length: 343)
Name: NF4445_low_50
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 325
Target Start/End: Original strand, 4746536 - 4746843
Alignment:
| Q |
18 |
agtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggttgggaaaatcacaaaatctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746536 |
agtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggttgggaaaatcacaaaatctc |
4746635 |
T |
|
| Q |
118 |
ccaccaggtgatatgggttggcctttctttggtaacatgcctaccttcgccaaatatgctaaatctgatcctgactcactcatctataaccttatctcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746636 |
ccaccaggtgatatgggttggcctttctttggtaacatgcctaccttcgccaaatatgctaaatctgatcctgactcactcatctataaccttatctcca |
4746735 |
T |
|
| Q |
218 |
ggtattcatccatctatgcttcggttcatctacaaaaccttgaaatataaataaataaaatcttatatttcaatatatgtaatatttgattttctttgtc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746736 |
ggtattcatccatctatgcttcggttcatctacaaaaccatgaaatataaataaataaaatcttatatttcaatatatgtaatatttgattttctttgtc |
4746835 |
T |
|
| Q |
318 |
tctttctt |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
4746836 |
tctttctt |
4746843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 4756142 - 4756289
Alignment:
| Q |
18 |
agtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggttgggaaaatcacaaaatctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4756142 |
agtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggttgggaaaatcacaaaatctc |
4756241 |
T |
|
| Q |
118 |
ccaccaggtgatatgggttggcctttctttggtaacatgcctaccttc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4756242 |
ccaccaggtgatatgggttggcctttctttggtaacatgcctaccttc |
4756289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University