View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_62 (Length: 313)
Name: NF4445_low_62
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_62 |
 | |
|
| [»] scaffold0536 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 24 - 258
Target Start/End: Complemental strand, 48911462 - 48911227
Alignment:
| Q |
24 |
gctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctccttcttccgtattcatcatctttg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48911462 |
gctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtagatggtaagtgctttctcttctccttcttccgtattcatcatctttg |
48911363 |
T |
|
| Q |
124 |
ccttgtcttctgtgtgtttggatactatatatgaattagaatgaacgtgatgatgagagaggtattgtactaattaattgtttctgctattgcttttaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
48911362 |
ccttgtcttctgtgtgtttggatactatgaatgaattagaatgaacgtgatgatgagagaggtattgtagcaattaactgtttctgctattgcttttaat |
48911263 |
T |
|
| Q |
224 |
gtccaacaatggaga-gatcctaactctggttgccc |
258 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48911262 |
gtccaacaatggagaggatcctaactctggttgccc |
48911227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 5628 - 5536
Alignment:
| Q |
24 |
gctatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctccttcttccgtattcatc |
116 |
Q |
| |
|
|||||||| |||| ||||||||| || ||||| |||||||||||||||||||| ||| |||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
5628 |
gctatgtcacataaagggatcatatgaccaggagctaagtaaggtatgaagtagatagtaagtgctttctcttctccttcttccatatccatc |
5536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 99
Target Start/End: Complemental strand, 9626 - 9553
Alignment:
| Q |
26 |
tatgtcgcatagagggatcatgtggccaggtgctaagtaaggtatgaagtatatattaagtggtttctcttctc |
99 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
9626 |
tatgtcgcatagagggatcatatgaccaggtgataagtaaggtatgaagtagattttaagtgctttctcttctc |
9553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 226
Target Start/End: Original strand, 31742730 - 31742786
Alignment:
| Q |
170 |
gtgatgatgagagaggtattgtactaattaattgtttctgctattgcttttaatgtc |
226 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |||| ||||||||||||| |||| |
|
|
| T |
31742730 |
gtgatgatgagagagttattgtagcaattaattatttccgctattgcttttagtgtc |
31742786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University