View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_63 (Length: 313)
Name: NF4445_low_63
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 41182933 - 41182726
Alignment:
| Q |
18 |
actacaagggggaaatgtcttgctaacttttaaaagtaactgcagttgtgatgttcatttgcaatttgccttattttacaatccaaacacttttacatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41182933 |
actacaagggggaaatgtcttgctaacttttaaaagtaactacagttgtgatgttcatttgcaatt-gccttattttacaatccaaacacttttacatgc |
41182835 |
T |
 |
| Q |
118 |
tgtaggacaagtacccttggatgaagtgtaatgactaatgacccacactcagcaaaaacaacagaccctgaaccaaagatttgtactgttaagcatgtaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41182834 |
tgtaggacaagtacccttggatgaagtgtaatgactaatgacccacactcagca---------------gaaccaaagatttgtactgttaagcatgtaa |
41182750 |
T |
 |
| Q |
218 |
agggtgaaacaaactaatccaata |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41182749 |
agggtgaaacaaactaatccaata |
41182726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 275 - 303
Target Start/End: Complemental strand, 41182692 - 41182664
Alignment:
| Q |
275 |
ggacaatagcattaatttgttcagaatta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41182692 |
ggacaatagcattaatttgttcagaatta |
41182664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University