View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_71 (Length: 304)
Name: NF4445_low_71
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_71 |
 |  |
|
| [»] scaffold0164 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0164 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 2309 - 2595
Alignment:
| Q |
1 |
tcttgaggtcacctttccggcgtggacctttaaagcttcaccatggtttgtccatggccgttcatggtgaatcttgattcagcgatggaaaaacccttag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2309 |
tcttgaggtcacctttccggcgaggacctttaaagcttcaccatggtttgtccatggccgttcatggtgaatcttgattcagcgatggaaaaacccttag |
2408 |
T |
 |
| Q |
101 |
aacaaacaatgaaatcgaaagttacgagcaaatccttcgctcaaatcctctccggcgaagatcctgatgcttccctcctggctcagcctcctctcaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2409 |
aacaaacaatgaaatcgaaagttacgagcaaatccttcactcaaatcctctccggcgaagatcctgagtcttccctcctggctcagcctcctctcaaagt |
2508 |
T |
 |
| Q |
201 |
ggttatgagcaacgcagttcgtgtgaaaatttctcgagcttcctatgaggttggcctagcagcgtgcaaaactcacctccatggaag |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2509 |
ggttatgagcaacgcagttcgtgtgaaaatttctcgagcttcctatgaggttggcctagcagcgtgcaaaactcacctccatggaag |
2595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University