View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_73 (Length: 302)
Name: NF4445_low_73
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_73 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 3273296 - 3273025
Alignment:
| Q |
14 |
actcaacgagagttgaacttacgaacttacagaagagtcaactctttactaaacaagctaaccttttgttgacattcnnnnnnnnagtttatgtaccatg |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||| |
|
|
| T |
3273296 |
actcaacgagagttgaacttacgatcttacagatgagtcaactctttactaaacaagttaaccttttgttgacatt-ttttttttagtttatgtagcatg |
3273198 |
T |
 |
| Q |
114 |
atcaaatgtgacattcataataaatggtgtcaatgaaaagcaatatatatttaaaattagattatatcaaacctatttattgacgaccnnnnnnnccata |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3273197 |
atcaaatgtgacattcataataaatggtgtcaatgaaaaccaatatatatttaaaattagattatatcaaacctatttattgacgaccaaaaaaatcata |
3273098 |
T |
 |
| Q |
214 |
taatatttatgtatcttttcatgatacgacaagcactctctcatgcatttttgcttgcaaacaaaatataaac |
286 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3273097 |
taatatttatgtatcttttcatgatatgacaagcactctctcatgcatttttgcttgcaaacaaaatataaac |
3273025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University