View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_81 (Length: 293)
Name: NF4445_low_81
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 9 - 277
Target Start/End: Original strand, 45469010 - 45469279
Alignment:
| Q |
9 |
caagaaaatgagaattgaggaagttgacgatgatgaaatggaagagtgaatttcagtgtcctgtagtgatgtttttctgtgaatatagtttgtggtcttc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45469010 |
caagaaaatgagaattgaggaagttgacgatgatgaaatggaagagtgaatttcattgtcctgtagtgatgtttttctgtgaatatagtttgtggtcttc |
45469109 |
T |
 |
| Q |
109 |
ttgaactatatagttttgtcaatttggattggtgtgtctgaaggatgaaactcaaatccttgaaggttgtaatatccg-cttttagtcgtgaataattaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45469110 |
ttgaactatatagttttgtcaatttggattggtgtgtctgaaggatgaaactcaaatccttgaaggttgtaatatccgttttttagtcgtgaataattaa |
45469209 |
T |
 |
| Q |
208 |
ttctgtttataagttcaattgcacaatactgttatttagtttgtggtttctttcttcattgattagctca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45469210 |
ttctgtttataagttcaattgcacaatattgttatttagtttgtggtttctttcttcattgattagctca |
45469279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University