View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_84 (Length: 288)
Name: NF4445_low_84
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 138 - 271
Target Start/End: Original strand, 47219570 - 47219703
Alignment:
| Q |
138 |
atcttattatgtttttagttctcctttatttcagaaatgatgtgtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47219570 |
atcttattatgtttttagttctcctttatttaagaaatgatgggtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
47219669 |
T |
 |
| Q |
238 |
actctataggggaaggaaggattaggtatcagtt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47219670 |
actctataggggaaggaaggattaggtatcagtt |
47219703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 47219502 - 47219566
Alignment:
| Q |
14 |
gagatgaaggtttagtctatttctctacttgttctcaatttcctctttctcgctttttactttct |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47219502 |
gagatgaaggtttagtctattactctacttgttctcaatttcctctttctcgcttttttctttct |
47219566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University