View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_low_90 (Length: 279)

Name: NF4445_low_90
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_low_90
NF4445_low_90
[»] chr4 (3 HSPs)
chr4 (163-214)||(231655-231706)
chr4 (11-42)||(231998-232029)
chr4 (14-51)||(46707465-46707502)
[»] chr3 (1 HSPs)
chr3 (14-51)||(25329898-25329935)


Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 231655 - 231706
Alignment:
163 catgcaactcttccattaacatatattgggcttcttcttcactgaagcctct 214  Q
    ||||||||||||||||||||| || ||||||||||  ||| |||||||||||    
231655 catgcaactcttccattaacacattttgggcttctctttcgctgaagcctct 231706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 232029 - 231998
Alignment:
11 aatgaggaacattgatcttatcatagtctctc 42  Q
    ||||||||||||||||||||||||||||||||    
232029 aatgaggaacattgatcttatcatagtctctc 231998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 51
Target Start/End: Original strand, 46707465 - 46707502
Alignment:
14 gaggaacattgatcttatcatagtctctctgcattata 51  Q
    ||||||||||||| |||||||||||| |||||||||||    
46707465 gaggaacattgattttatcatagtctttctgcattata 46707502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 51
Target Start/End: Complemental strand, 25329935 - 25329898
Alignment:
14 gaggaacattgatcttatcatagtctctctgcattata 51  Q
    ||||||||||||| |||||||||||||||| |||||||    
25329935 gaggaacattgattttatcatagtctctctacattata 25329898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University