View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_low_99 (Length: 255)
Name: NF4445_low_99
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_low_99 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 2386556 - 2386792
Alignment:
| Q |
19 |
gaaacaggaacaaccccttgcaaattgttgttagccaaattcaattgtttcaacaatggcaagcttatatcaggaatttcaccggaaagcgagttgtttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2386556 |
gaaacaggaacaaccccttgcaaattgttgttagccaaattcaactgtttcaacaatggcaagcttatatcaggaatttcaccggaaagcgagttgtttg |
2386655 |
T |
 |
| Q |
119 |
cgagattcaaataaacaaggtgactcaaattggaaagagataaaggaatttcaccaatgaaacggttattagacaaattaacaacagataaattcttcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2386656 |
cgagattcaaataaacaaggtgactcaaattggaaagagataaaggaatttcaccaatgaaacggttattagacaaattaacaacagataaattcttcca |
2386755 |
T |
 |
| Q |
219 |
aacagcaaaatctggcaatggacctatgatattgttg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2386756 |
aacagcaaaatctggcaatggacctatgatattgttg |
2386792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University