View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4446_high_4 (Length: 268)
Name: NF4446_high_4
Description: NF4446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4446_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 32276814 - 32276563
Alignment:
| Q |
17 |
tatctattatgatgtttttgcaatgattagtct--catcatttctaaaatgttgtaattgtgtcacact--tacaaatcatggtgatcatgtctcaaatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32276814 |
tatctattatgatgtttttgcaatgattagtctttcatcatttctaaaatgttgtaattgtgtcacacaggtacaaatcatggtgatcatgtctcaaatc |
32276715 |
T |
 |
| Q |
113 |
aattgttagatggtttaacattaatatactatgaatgtgcgttgtctcccatatagtacaatatcaatttttcatttcccatattaagatggaatcattt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32276714 |
aattgttagatggtttaacattaatatactatgaatgtgcgttgtctcccatatagtacaatatcaatttttcatttcccatattaaaatggaatcattt |
32276615 |
T |
 |
| Q |
213 |
ctaaatttatgacaaccgacatgctaatagaaacaaaatgcttactccgtga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32276614 |
ctaaatttatgacaaccgacatgctaatagaaacaaaatgcttactccgtga |
32276563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University