View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4446_low_6 (Length: 243)
Name: NF4446_low_6
Description: NF4446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4446_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 32276430 - 32276201
Alignment:
| Q |
1 |
ttttagggaaaattctcaaagaattattcttcttattcatggc---tactactact---actatcatcgagttacttgcctttgtctttgtggtaattgt |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
32276430 |
ttttagagaaaattctcaaagaattattcttcttattcatggcggctactactactactactatcatcaagttacttgcctttgtctttgtggtaattat |
32276331 |
T |
 |
| Q |
95 |
cttacttgaaaattcacatgctgtgagttctactactactgagccaacaatctcagcttctccaggtgttttaccttatgtgacttctccagatatttct |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32276330 |
cttacttgacaattcacatgctgtgagttctactactactgagccaacaatctcagcttctccaggtgttttaccttatgtgacttctccagatatttct |
32276231 |
T |
 |
| Q |
195 |
tcatttttccctactccaatgagttcctct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32276230 |
tcatttttccctactccaatgagttcctct |
32276201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University