View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4447-Insertion-10 (Length: 153)
Name: NF4447-Insertion-10
Description: NF4447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4447-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 153
Target Start/End: Complemental strand, 36780143 - 36779998
Alignment:
| Q |
8 |
ctactgtctgtcgccattacttgagcacgttacaccaggtttctcattactaaccttctattctataaatagatatcaatactctccaaccaaataaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36780143 |
ctactgtctgtcgccattacttgagcacgttacaccaggtttctcattactaaccttctattctataaatagatatcaatactctccaaccaaataaaca |
36780044 |
T |
|
| Q |
108 |
cacaccaaaaatggcaactatgattggaggatctgttttgctatgc |
153 |
Q |
| |
|
||| ||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
36780043 |
cacgccaaaaatggcgactatgtttggaggatctgttttgctatgc |
36779998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University