View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4447_low_1 (Length: 249)

Name: NF4447_low_1
Description: NF4447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4447_low_1
NF4447_low_1
[»] chr2 (1 HSPs)
chr2 (1-211)||(2181946-2182157)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 2182157 - 2181946
Alignment:
1 cacatatgaatgattctagacaaaaaatgactccaagcaatgatttttaaaaagaacttcgagataaggtaaagtttttctctctnnnnnnnn-taggga 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||    
2182157 cacatatgaatgattctagacaaaaaatgactccaagcaatgatttttaaaaagaacttcgagataaggtaaagtttttctctctaaaaaaaaataggga 2182058  T
100 cgtctcaatttttaaaatctcatcatatcttgacaaatatagattttttcatcacatttattttcacaataatgataaataaacactaaaaaatttgata 199  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||  | |||||||||||    
2182057 cgtctcaatttttaaaatctcatcatatcttgataaatatagattttttcatcacatttattttcacaataatgataaataagcatgagaaaatttgata 2181958  T
200 gtcattcaacat 211  Q
    ||||||||||||    
2181957 gtcattcaacat 2181946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University