View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4448-Insertion-6 (Length: 327)
Name: NF4448-Insertion-6
Description: NF4448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4448-Insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 74 - 311
Target Start/End: Complemental strand, 43353531 - 43353302
Alignment:
| Q |
74 |
gaagaatttgcatttttaataggaatatttgtcacggctttatcattattaatttagtaattttgaataaatatgccaatcaactcaatttataaaattt |
173 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43353531 |
gaagaatttgcctttttaatagaaatatttgtcacggctttatcattattaatttagtaattttgaacaaatatgccaatcaactcaatttataaaattt |
43353432 |
T |
|
| Q |
174 |
atgatcgtcattcagcgtattcaactattcattcatcctaaaaaagtggcaaaaatttatcaaatttgagcaattattcttgcatctcaaagataagaac |
273 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43353431 |
atgatcgtcattcagcgta--------ttcattcatcctaaaaaagtggcaataatttatcaaatttgagcaattattcttgcatctcaaagataagaac |
43353340 |
T |
|
| Q |
274 |
gaaagaaacgatgaggcaaagaaaagaaggtagcactg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43353339 |
gaaagaaacgatgaggcaaagaaaagaaggtagtactg |
43353302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 43354733 - 43354658
Alignment:
| Q |
8 |
gggacctctattgttttgcaaggacagtgagcctccgatttaggaatttatannnnnnnaggaaaggaagaatttg |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43354733 |
gggacctctattgttttgcaaggacagtgagcctccgatttaggaatttatatttttttaggaaaggaagaatttg |
43354658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University