View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4448_low_3 (Length: 239)
Name: NF4448_low_3
Description: NF4448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4448_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 37346973 - 37346748
Alignment:
| Q |
1 |
cagatccagcacttggccattctccaatgccgcgtttgttgatggaaagaggacgaagcggtggaagcaacgatcgttgtttgtttttcaccgctgccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37346973 |
cagatccagcacttggccattctccaatgctgcgtttgttgatggaaagaggacgaagcggtggaagcaacgatcgttgtttgtttttcaccgccgccga |
37346874 |
T |
 |
| Q |
101 |
cggtgttggcggccttctgtttgaaggtgaacagtctgtccatgaaactgaccgtgaaaatgtactcgggtaaccactaccgccaccaccggtggcggcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37346873 |
cggtgttggcggccttctgtttgaaggtgaacagtctgtccatgaaactgaccgtgaaaatgtactccggtaaccactaccgccaccaccggtggcggcg |
37346774 |
T |
 |
| Q |
201 |
cggtcgttactctccgacatcaaaag |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37346773 |
cggtcgttactctccgacatcaaaag |
37346748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 48621406 - 48621353
Alignment:
| Q |
32 |
gcgtttgttgatggaaagaggacgaagcggtggaagcaacgatcgttgtttgtt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| ||||| ||||||| |
|
|
| T |
48621406 |
gcgtttgttgatggaaagaggacgaagcagtgaaagcaatgatcgaggtttgtt |
48621353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University