View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4449_low_7 (Length: 204)
Name: NF4449_low_7
Description: NF4449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4449_low_7 |
 |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0276 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 14848 - 15036
Alignment:
| Q |
1 |
agcacaaaatttagccaaatggtaatttaattgannnnnnnnccaaattatttgaatgttgaaatgtgaatccagatctgcttattactattgctacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14848 |
agcacaaaatttagccaaatggtaatttaattgattttttttccaaattatttgaatgttgaaatgtgaatccagatctgcttattcctattgctacttt |
14947 |
T |
 |
| Q |
101 |
gtttatttttaatggattttcttcattattgcttggaattgtaatccgattgtgtttgtttggctgttatacaattctgatctgttttg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14948 |
gtttatttttaatggattttcttcattattgcttggaattgtaatccgattgtgtttgtttggctgttatacaattctgatctgttttg |
15036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University