View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4450-Insertion-10 (Length: 226)
Name: NF4450-Insertion-10
Description: NF4450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4450-Insertion-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 48600230 - 48600016
Alignment:
| Q |
8 |
gattttgtgatttcagctgttatagatgccgctttgcatggaatattagtcgtcttggtgtgaattaatcacggtgttagctatctattgaacttatcca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600230 |
gattttgtgatttcagctgttatagatgcagctttgcatggaatattagtcgtcttggtgtgaattaatcacggtgttagctatctattgaacttatcca |
48600131 |
T |
 |
| Q |
108 |
atagaagataagatagcatttcataagttatagcatagttaggtgataatactattgcatatgataatccttttcttctcccttgttcatgcattcatac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600130 |
atagaagataagatagcatttcataagttatagcatagttaggtgataatactattgcatatgataatccttttcttctcccttgttcatgcattcatac |
48600031 |
T |
 |
| Q |
208 |
tgcaatgccattttt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48600030 |
tgcaatgccattttt |
48600016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University