View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4450_high_5 (Length: 237)
Name: NF4450_high_5
Description: NF4450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4450_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 4750074 - 4750294
Alignment:
| Q |
1 |
attgatgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccatatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4750074 |
attgatgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccatatatt |
4750173 |
T |
 |
| Q |
101 |
tttctgcgttgttaattttgtactccatgacaactccctagcatggttttggtcgcagttgataacaaatttttagttgcagacaaatgtagtcaatacg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4750174 |
tttctgcgttgataattttgtactccatgacaactccctagcatggttttggtcgcagttgataacaaatttttagttgcagacaaatgtagtcaatacg |
4750273 |
T |
 |
| Q |
201 |
aatgcaattacgattgcagat |
221 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
4750274 |
actgcaattacgattgcagat |
4750294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 4758394 - 4758493
Alignment:
| Q |
1 |
attgatgagatgctgcgcaaaacaagtatttcatttgcgaactttagacaggcaaaagttgattttaacctcaatggttagtcatttcattccatatatt |
100 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||| || ||||||| ||||||||||||| ||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
4758394 |
attgatgagatgctgcgcataacaacaatctcatttgcaaattttagacgggcaaaagttgatgttaacatcaatggttagttattccattccatatatt |
4758493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University