View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4450_high_6 (Length: 235)
Name: NF4450_high_6
Description: NF4450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4450_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 217
Target Start/End: Original strand, 43054966 - 43055171
Alignment:
| Q |
12 |
aagcaaagggaatcttagaatgcaattgaaatgttgggagaaagtttgggaaaacttgtggaattattaacttagtcacacagtctaacccttcacggct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054966 |
aagcaaagggaatcttagaatgcaattgaaatgttgggagaaagtttgggaaaacttgtggaattattaacttagtcacacagtctaacccttcacggct |
43055065 |
T |
 |
| Q |
112 |
atgtcagtcattaacaagtttttgcttgaagcacaagtttcttaaacacaattcacattttgccgtgctctacttggtcaatcaaacattttctttcgaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43055066 |
atgtcagtcattaacaagtttttgcttgaagcacaagtttcttaaacacaattcacattttgccgtgctctacttggtcaatcaaacattttctctcgaa |
43055165 |
T |
 |
| Q |
212 |
tattct |
217 |
Q |
| |
|
|||||| |
|
|
| T |
43055166 |
tattct |
43055171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University