View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4450_low_9 (Length: 223)
Name: NF4450_low_9
Description: NF4450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4450_low_9 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 37 - 223
Target Start/End: Complemental strand, 4749617 - 4749431
Alignment:
| Q |
37 |
cagtaacaaattttgaaaatgccacattaattaatagtattaaaaccttggctctttcgaagacatgtggatgattagtgaggttgataacggtccacaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749617 |
cagtaacaaattttgaaaatgccacattaattaatagtattaaaaccttggctctttcgaagacatgtggatgattagtgaggttgataacggtccacaa |
4749518 |
T |
 |
| Q |
137 |
aacaccataagcagagctttcatgaccagctaacaagaacaaaagaagcaagtctataatgtcttcatcttccaacttctcaccctc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749517 |
aacaccataagcagagctttcatgaccagctaacaagaacaaaagaagcaagtctataatgtcttcatcttccaacttctcaccctc |
4749431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 81 - 212
Target Start/End: Complemental strand, 4758054 - 4757923
Alignment:
| Q |
81 |
accttggctctttcgaagacatgtggatgattagtgaggttgataacggtccacaaaacaccataagcagagctttcatgaccagctaacaagaacaaaa |
180 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| | |||||| |||| |||||||||| |||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
4758054 |
accttggccctttggaagacatgtggatgatcaatgaggtaaataatagtccacaaaattccatgagcagagctttcatgaccagctaacaagaacacaa |
4757955 |
T |
 |
| Q |
181 |
gaagcaagtctataatgtcttcatcttccaac |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
4757954 |
gaagcaagtctataatgtcttcatcctccaac |
4757923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University