View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452-Insertion-11 (Length: 295)
Name: NF4452-Insertion-11
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452-Insertion-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 7 - 295
Target Start/End: Original strand, 45362319 - 45362607
Alignment:
| Q |
7 |
agtgaggagatcaaatgcttcaagaaggtctcattctcagtctcatacaacacctcgagcttcaaatctgacgaatgcagagatatactctttgcaatca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362319 |
agtgaggagatcaaatgcttcaagaaggtctcattctcagtctcatacaacacctcgagcttcaaatctgacgaatgcagagatatactctttgcaatca |
45362418 |
T |
 |
| Q |
107 |
tcaaggaatccaactccaagagggtctagtttcaaccacacagatttacattccatgatgggtggtagtcgtaattctaactttggtgcttctgatttga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45362419 |
tcaaggaatccaactccaagagggtctagtttcaaccacacagatttacattccatgatgggtggtagtcgtaattctaactttggtgcttttgatttga |
45362518 |
T |
 |
| Q |
207 |
aaggaacaccaccgaggacttgtaattatgataattcagtgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgttctct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362519 |
aaggaacaccaccgaggacttgtaattatgataattcaatgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgttctct |
45362607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University