View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452-Insertion-14 (Length: 142)
Name: NF4452-Insertion-14
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 12 - 142
Target Start/End: Complemental strand, 42250630 - 42250500
Alignment:
| Q |
12 |
tagcttcattccctcaaagtcttatggccctcagagttgcttccaagtctccagcttctcacttttatacatccattcgatcaaattacaccatgtgtaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
42250630 |
tagcttcattccctcaaagtcttatggccctcagagttgcttccaagtctccagcttctcacttttatacatccatacaatcaaattacaccatgtgtaa |
42250531 |
T |
 |
| Q |
112 |
ataaatgacaccatttaaacatttgtagaga |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42250530 |
ataaatgacaccatttaaacatttgtagaga |
42250500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University