View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4452-Insertion-15 (Length: 131)

Name: NF4452-Insertion-15
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4452-Insertion-15
NF4452-Insertion-15
[»] chr7 (3 HSPs)
chr7 (12-99)||(48089421-48089508)
chr7 (14-69)||(33003068-33003123)
chr7 (99-131)||(48089371-48089403)
[»] chr8 (1 HSPs)
chr8 (14-84)||(18076005-18076075)
[»] chr2 (1 HSPs)
chr2 (15-84)||(40372931-40373000)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 1e-42; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 48089508 - 48089421
Alignment:
Q  12 cacctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgcttctattgtcactttag 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48089508 cacctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgcttctattgtcactttag 48089421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 33003068 - 33003123
Alignment:
Q  14 cctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagtttt 69  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||    
T  33003068 cctcttgccctcctctcatcctctctctcaactttcaatctcatctccttagtttt 33003123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 131
Target Start/End: Complemental strand, 48089403 - 48089371
Alignment:
Q  99 gtgcatagtgtttatttttatgaaattgctaag 131  Q
    |||||||||||||||||||||||||||||||||    
T  48089403 gtgcatagtgtttatttttatgaaattgctaag 48089371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 18076075 - 18076005
Alignment:
Q  14 cctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgctt 84  Q
    |||||||||||||| | ||||||||||||||||||||||||| |||||||||||||| ||||| |||||||    
T  18076075 cctcttgccctcttgtcatcctctctctcaactttcaatctcgtccccttagttttgatgtgctgctgctt 18076005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 5e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 40373000 - 40372931
Alignment:
Q  15 ctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgctt 84  Q
    |||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||  |||||||    
T  40373000 ctcttgtcctcttctcatcctcactctcaactttcaatctcatccccttagttttggtgtgttgctgctt 40372931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University