View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452-Insertion-15 (Length: 131)
Name: NF4452-Insertion-15
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452-Insertion-15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 1e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 12 - 99
Target Start/End: Complemental strand, 48089508 - 48089421
Alignment:
| Q |
12 |
cacctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgcttctattgtcactttag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48089508 |
cacctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgcttctattgtcactttag |
48089421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 33003068 - 33003123
Alignment:
| Q |
14 |
cctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagtttt |
69 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33003068 |
cctcttgccctcctctcatcctctctctcaactttcaatctcatctccttagtttt |
33003123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 131
Target Start/End: Complemental strand, 48089403 - 48089371
Alignment:
| Q |
99 |
gtgcatagtgtttatttttatgaaattgctaag |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48089403 |
gtgcatagtgtttatttttatgaaattgctaag |
48089371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 18076075 - 18076005
Alignment:
| Q |
14 |
cctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgctt |
84 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
18076075 |
cctcttgccctcttgtcatcctctctctcaactttcaatctcgtccccttagttttgatgtgctgctgctt |
18076005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 5e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 40373000 - 40372931
Alignment:
| Q |
15 |
ctcttgccctcttcttatcctctctctcaactttcaatctcatccccttagttttggtgtgcagctgctt |
84 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40373000 |
ctcttgtcctcttctcatcctcactctcaactttcaatctcatccccttagttttggtgtgttgctgctt |
40372931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University