View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452_high_23 (Length: 236)
Name: NF4452_high_23
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 36935204 - 36935422
Alignment:
| Q |
1 |
cagtgattattaggagacaaaaatgttgaagagacttgctataactcctcacnnnnnnngagtgattattataaatgcaggtcacgctgaggaataaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36935204 |
cagtgattattaggagacaaaaatgttgaagagactttctataactcctccctttttttgagtgattattataaaagcaggtcacgctgaggaataaaag |
36935303 |
T |
 |
| Q |
101 |
ggagctatttattgagtttaggatatcatagtttttgtaaacnnnnnnnnnnnnnnnnngatagcatggtcataactagatttacgtaactagattgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36935304 |
ggagctatttattgagtttaggatgtcatagtttttgtaaacaaaaaataaaataaaaagatagcatggtcataactagatttacgtaactagattgcca |
36935403 |
T |
 |
| Q |
201 |
ctgtttaaaaagtaggcaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36935404 |
ctgtttaaaaagtaggcaa |
36935422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University