View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452_low_24 (Length: 237)
Name: NF4452_low_24
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 11054456 - 11054675
Alignment:
| Q |
1 |
tacaacaaagaaaatcagtcttgccgagcatgaatactctccttcttcaccttgcaaacatgtcccattacctgttctattttcctggttggagaacaaa |
100 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| |||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11054456 |
tacaacagagaaaatcagtcttgacgagcatgaatactc--cttcctcaccttgcaaacacatcccattacttgttctattttcctggttggagaacaaa |
11054553 |
T |
 |
| Q |
101 |
tcgtctacgtcgtatctaagtctacctcgttgtggtcgttgcaatctcacctacgcataacaagctgctgcctcacaatgtcgcatccctgctgttacgg |
200 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11054554 |
tcgtctacgttgtatttaaatctacctcgttgtggtcgttgcaatctcacctacgcataacaaactgccgcctcacaatgtcgcatccctgctgttacgg |
11054653 |
T |
 |
| Q |
201 |
aagtggagtgttggtctatatt |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
11054654 |
aagtggagtgctggtctatatt |
11054675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University