View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452_low_26 (Length: 232)
Name: NF4452_low_26
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 11034032 - 11034229
Alignment:
| Q |
20 |
gtttcgaaaagaacagaatatgggtaggcaaccaaataactcatgcgaaaaatattgcccaatattacttactattgacaagttttttagaagaaaagac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11034032 |
gtttcgaaaagaacagaatatgggtaggcaaccaaataactcatgcgaaaaatattgcccaata----ttactatttacaagttttttagaagaaaagac |
11034127 |
T |
|
| Q |
120 |
atcatactaacaacagaacaagnnnnnnnnnatagtttttgtactgaaaatttgttttctaaactttattttaagtcttatgtcttgcttacctatgcta |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
11034128 |
atcatactaacaacagaacaag-ttttttttatagtttttgtactgaaaatttgttttctaaactttattttaagtcttatgtcttgcttacctgtgcga |
11034226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University