View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4452_low_28 (Length: 210)
Name: NF4452_low_28
Description: NF4452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4452_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 14072245 - 14072069
Alignment:
| Q |
16 |
aagaagaaaaatgggttaacgatgtgtccgagtcgtctctaaggatattagaagtatgtggtatgtccaaagatgttcttttgtttgtaaaagaacatct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14072245 |
aagaagaaaaatgggttaacgatgtgtccgagtcatctctaaggatattagaagtatgtggtatgtccaaagatgttcttttgtttgtaaaagaacatct |
14072146 |
T |
 |
| Q |
116 |
tcaagagcttcaatttacattgcgtagagcaagcattggtgagccaggaattgaggagaaaatcacttcacacaatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14072145 |
tcaagagcttcaatttacattgcgtagagcaagcattggtgagccaggaattgaggagaaaatcacttcacacaatt |
14072069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University