View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4453_high_4 (Length: 306)
Name: NF4453_high_4
Description: NF4453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4453_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 5 - 292
Target Start/End: Original strand, 42163603 - 42163890
Alignment:
| Q |
5 |
gagaagcataggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttc |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163603 |
gagaagcctaggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttc |
42163702 |
T |
|
| Q |
105 |
tctttgtaccatccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccgcgcccagaattgaacaggggatttgtttccagttc |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163703 |
tctttgtaccatccattatgctagcctccatttcaactgttccttttgctgtcaaagcagatccacgcccagaattgaacaggggatttgtttccagttc |
42163802 |
T |
|
| Q |
205 |
tctcacctgtcaaaaaagagactccaaatcattaaacatgattaacaaatgacttaatgaagcaaaaatcttgttattgttttgtttt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42163803 |
tctcacctgtcaaaaaagagactccaaatcattaaacatgattaacaaatgacttaatgaagcaaaaatcttgttattgttttttttt |
42163890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 5480656 - 5480776
Alignment:
| Q |
92 |
gcaccacatcttctctttgtaccatccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccgcgcccagaattgaacaggggat |
191 |
Q |
| |
|
||||| |||| ||| |||| |||||||| ||||||||||||||||| || ||||||||| | |||| |||||||| || || |||||||| || |||| |
|
|
| T |
5480656 |
gcaccgcatcgtctttttggtccatccattatgctagcctccatttccaccgttcctttttccgtcagggcagatccacgacccgaattgaatagtggat |
5480755 |
T |
|
| Q |
192 |
ttgtttccagttctctcacct |
212 |
Q |
| |
|
||||||| ||| ||||||| |
|
|
| T |
5480756 |
ccgtttccaattccctcacct |
5480776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 47170742 - 47170573
Alignment:
| Q |
14 |
aggtatgaatgaggggacttttccatgacaaggcgagcaagtgagacagggtttttcacggtggtaacaccagatacagcaccacatcttctctttgtac |
113 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| |||| || ||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
47170742 |
aggtaggaatgaggggatttttccatgacaagacgagcaagagagattggatttttcacggtggaaacaccagatacagcaccacatcttctcttggtac |
47170643 |
T |
|
| Q |
114 |
catccatgatgctagcctccatttcaactgttccttttgctgtcaaagcagatccgcgcccagaattgaa |
183 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
47170642 |
catccatgatactagcctccatttccaccgttccttttgctgtcagagcagatccacggccagaattgaa |
47170573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University