View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4454-Insertion-11 (Length: 106)
Name: NF4454-Insertion-11
Description: NF4454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4454-Insertion-11 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 61; Significance: 1e-26; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 33051 - 32979
Alignment:
| Q |
8 |
gaaagatgaaaaaccgattgaaaatctgatcttatacgcgcccgcctccttcgttttgtcttcaaccagcgta |
80 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33051 |
gaaagatgaaaaactgattgaaaatctgatcttatacgcgccttcctccttcgttttgtcttcaaccagcgta |
32979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University