View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4454_high_6 (Length: 254)
Name: NF4454_high_6
Description: NF4454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4454_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 4069549 - 4069788
Alignment:
| Q |
5 |
acttgttcaccttttatactaatgtttgtttattatatagtttataaaagaaatgatttttacatttttaagagtcaaagaagcatgaatatatcttaca |
104 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4069549 |
acttgttcaccttttatactaagggttgtttattatatagtttataaaagaaatgatttttacatttttaagagtcaaaggagcatgaatatatcttaca |
4069648 |
T |
 |
| Q |
105 |
caatttgatgtgggttccaaagaattttgtagtcatgaaaatcagttgtgggatcaaaccaaaggtggattttttgctctctatccccttcaccatttgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069649 |
caatttgatgtgggttccaaagaattttgtagtcatgaaaatcagttgtgggatcaaaccaaaggtggattttttgctctctatccccttcaccatttgc |
4069748 |
T |
 |
| Q |
205 |
ccatacattggtttgtaatgcatatggtttcccttctctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069749 |
ccatacattggtttgtaatgcatatggtttcccttctctg |
4069788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University