View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4454_low_4 (Length: 258)
Name: NF4454_low_4
Description: NF4454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4454_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 216
Target Start/End: Original strand, 12546735 - 12546843
Alignment:
| Q |
108 |
caaataaaattgacaattattaacaaagatcttaggaaaatgatattcaattcaattaagaaacagtagaaaagagcattgttacaagataaccataggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| |
|
|
| T |
12546735 |
caaataaaattgacaattattaacaaagaacataggaaaatgatattcaattcaattaagaaacagtagaacagagcattgtcacaagataaccatgggt |
12546834 |
T |
 |
| Q |
208 |
taaccttca |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
12546835 |
taaccttca |
12546843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 180 - 258
Target Start/End: Complemental strand, 12537266 - 12537188
Alignment:
| Q |
180 |
agagcattgttacaagataaccataggttaaccttcaatacagaatataaaaacaacatcaaaatcataaaccaaaccc |
258 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||| |||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
12537266 |
agagcattgttaaaagataacaataggttaactttcattacagaatattaaaactacatcaaaatcataaaccaaaccc |
12537188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University