View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4455-Insertion-12 (Length: 312)
Name: NF4455-Insertion-12
Description: NF4455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4455-Insertion-12 |
 | |
|
| [»] chr8 (5 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 140 - 312
Target Start/End: Complemental strand, 9335751 - 9335579
Alignment:
| Q |
140 |
ttgaggatttcattcatcatttatgtttccatatgactgaattgagttactggcccttgtggcaggtttttgcaaaaacccgtacattgtatttcatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9335751 |
ttgaggatttcattcatcatttatgtttccatatgactgaattgagttactggcccttgtagcaggtttttgcaaaaacctgtacattgtatttcatatt |
9335652 |
T |
|
| Q |
240 |
ggcctctagtgaccgctactgactggatcatttgcatatttaaatcatatggttcatttgatttattttctaa |
312 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9335651 |
ggcctctggtgaccgctactgaatggatcatttgcatatttaaatcatatggttcatttgatttattttctaa |
9335579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 8 - 106
Target Start/End: Complemental strand, 9336248 - 9336150
Alignment:
| Q |
8 |
gatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataatttaatacttgatttctactt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336248 |
gatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataatttaatacttgatttctactt |
9336150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 8209226 - 8209157
Alignment:
| Q |
19 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt |
88 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| || | |||||||| ||||||| |
|
|
| T |
8209226 |
gaaggcacttgatgcattgattgcttacttgcatgctgcagatgctgacgctgcgaggtgatcataattt |
8209157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 9937802 - 9937755
Alignment:
| Q |
19 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctga |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9937802 |
gaaggcactcgatgcgttgattgcttacttgcgagatgcagatgctga |
9937755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 143
Target Start/End: Complemental strand, 9336056 - 9336026
Alignment:
| Q |
113 |
tatttaacattttttatttgagtgaatttga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9336056 |
tatttaacattttttatttgagtgaatttga |
9336026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 42364974 - 42364910
Alignment:
| Q |
19 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataat |
83 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
42364974 |
gaaggcacttgatgcattgattgcttacttgcgagctgcagatgctgacgctagcaggtgataat |
42364910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University