View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4455-Insertion-13 (Length: 203)
Name: NF4455-Insertion-13
Description: NF4455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4455-Insertion-13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 29691221 - 29691416
Alignment:
| Q |
9 |
ttactatacatgatgctgattttcagataccatggctgcggtgaccctatagcagttattatagtttttacggattctgtctcagattatacatacgttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29691221 |
ttactatacatgatgctgattttcagataccatggctgcggtgaccctatagcagttattttagtttttacggattctgtctcaaattatacatacgttg |
29691320 |
T |
 |
| Q |
109 |
tattataatatcaatataaaataattttgttcttcctaaataatctttgtctattgttatctttttactac-ttttttaactcaagcatattttca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29691321 |
tattataatatcaatataaaataattttgttcttcctaaataatctttgtctattgttatctttttactactttttttaactcaagcatattttca |
29691416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University