View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4455-Insertion-14 (Length: 182)
Name: NF4455-Insertion-14
Description: NF4455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4455-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 7 - 182
Target Start/End: Complemental strand, 45936504 - 45936329
Alignment:
| Q |
7 |
atgatgaaccatagtgaccaaataagagcactgagaattaagagaatagggcctagaagcacattattagattgggcagcagaggagttatcaccagctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45936504 |
atgatgaaccatagtgaccaaataagagcactgagaattaagagaatagggcctagaagcacattattagattgggcagcagaggagttatcaccagctc |
45936405 |
T |
|
| Q |
107 |
cttcaattctctcagcataactccaatgaatttttgattctggtataccaattacttgtccatggtaaaatgatag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45936404 |
cttcaattctctcagcataactccaatgaatttttgattctggtataccaattacttgtccatggtaaaatgatag |
45936329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 10561854 - 10561796
Alignment:
| Q |
7 |
atgatgaaccatagtgaccaaataagagcactgagaattaagagaatagggcctagaag |
65 |
Q |
| |
|
||||| |||||||||||||||| ||||||| | ||||||||||| | |||||||||||| |
|
|
| T |
10561854 |
atgataaaccatagtgaccaaacaagagcattaagaattaagagcacagggcctagaag |
10561796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University