View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4455-Insertion-16 (Length: 68)
Name: NF4455-Insertion-16
Description: NF4455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4455-Insertion-16 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 6e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 25334875 - 25334935
Alignment:
| Q |
8 |
caaagcatataccacattgtttctttgctgcatgagtatgtgaggtaacttttttcgacga |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25334875 |
caaagcatataccacattgtttctttgctgcatgagtatgtgaggtaacttttttcgacga |
25334935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 25345947 - 25346007
Alignment:
| Q |
8 |
caaagcatataccacattgtttctttgctgcatgagtatgtgaggtaacttttttcgacga |
68 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||| || ||||| || || ||||||||| |
|
|
| T |
25345947 |
caaagcatataccacatgttttctttgcttcatgagcatctgaggaaatttgtttcgacga |
25346007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University